Forum
»
It’s Official - Boosters For Everyone!
09-17-2023, 08:26 AM
-
#331
- x-trainer ben
- Registered User
-
- x-trainer ben
- Registered User
- Join Date: Oct 2005
- Location: United States
- Posts: 62,386
- Rep Power: 451180
-
-
Originally Posted By Bushmaster⏩
And what current new questions did you asked me in your old man rambling?Lol right Benny.. You Rnaholic fux shiit your pants in horror every time a fresh new variant drops. Get all tingly and excited in anticipation of a new vax for it too.
And when it does you Rnaholic fux shiit your pants in horror every time a fresh new variant drops. Get all tingly and excited in anticipation of a new vax for it too.
But it's still funny.
And when it does you Rnaholic fux shiit your pants in horror every time a fresh new variant drops. Get all tingly and excited in anticipation of a new vax for it too.
But it's still funny.

That's right none............ you just made statements that were not factual, accurate, or correct( the old people call that lying).
Bless your heart.....
You should just talk to yourself here.
You really don't need anyone else to respond at all, when you just make chit up and reply to yourself.
Aee are on to you and your game.
There is an unspoken thing, we are iron brothers and sisters, we are to support each other and...It is our duty to support our brothers and sisters in the iron game!
09-17-2023, 08:46 AM
-
#332
- Bushmaster
- Masculine Toxicity
-
- Bushmaster
- Masculine Toxicity
- Join Date: Jul 2003
- Location: Greenville, South Carolina, United States
- Posts: 68,361
- Subscribers: 2
- Rep Power: 700751
-
-
Originally Posted By uncle
I didn't ask you any questions Benny. Know why.?And what current new questions did you asked me in your old man rambling?
That's right none............ you just made statements that were not factual, accurate, or correct( the old people call that lying).
Bless your heart.....
You should just talk to yourself here.
You really don't need anyone else to respond at all, when you just make chit up and reply to yourself.
Aee are on to you and your game.
That's right none............ you just made statements that were not factual, accurate, or correct( the old people call that lying).
Bless your heart.....
You should just talk to yourself here.
You really don't need anyone else to respond at all, when you just make chit up and reply to yourself.
Aee are on to you and your game.
1. I'm not interested in hearing any of your Rona paranoia.
2. I have no desire to learn anything about your sacred Rona.
3. It's much more fun to LMAO at you.

It's a hot night. The mind races. You think about your knife: the only friend who hasn't betrayed you, the only friend who won't be dead by sunup. Sleep tight mates, in your quilted chambray night shirts.
09-17-2023, 09:10 AM
-
#333
- Paul Kreul
- Registered User
-
- Paul Kreul
- Registered User
- Join Date: Apr 2006
- Location: United States
- Posts: 33,385
- Rep Power: 316746
-
-
Originally Posted By J.L.C.⏩
https://www.researchgate.net/publica...irus_assays_14If you want to claim that assay is identical to current commercial assays for covid, that's gonna require some support/evidence
There's more to it than length (that's what he/she said).
Does it differentiate between dead and alive nucleotides?
Why don't skeptics just publish the sequences and mass spec results?

There's more to it than length (that's what he/she said).
Does it differentiate between dead and alive nucleotides?
Why don't skeptics just publish the sequences and mass spec results?
https://academic.oup.com/HTTPHandler...lementary-data
The published genome (2020) of SARS-Cov-2 (Wuhan-Hu-1) from Genbank
https://www.ncbi.nlm.nih.gov/nuccore/NC_045512
here is the 2006 sequence they call SARS-CoV-2 insert, 190 nucleotides long:
atgaattaccaagtcaatggttaccctaatatgtttatcacccgcgaaga agctat
tcgtcacgttcgtgcgtggattggctttgatgtagagggctgtcatgcaa ctagagat
gctgtgggtactaacctacctctccagctaggattttctacaggtgttaa cttagtagc
tgtaccgactggttatg
Same sequence is found in the 2020 Genbank submission for SARS-CoV-2 (Wuhan-Hu-1)
https://www.ncbi.nlm.nih.gov/nuccore/NC_045512
Can you explain how that is even possible?
09-17-2023, 09:14 AM
-
#334
Originally Posted By Paul
So it's 190 now? Not 26?https://www.researchgate.net/publica...irus_assays_14
https://academic.oup.com/HTTPHandler...lementary-data
The published genome (2020) of SARS-Cov-2 (Wuhan-Hu-1) from Genbank
https://www.ncbi.nlm.nih.gov/nuccore/NC_045512
here is the 2006 sequence they call SARS-CoV-2 insert, 190 nucleotides long:
atgaattaccaagtcaatggttaccctaatatgtttatcacccgcgaaga agctat
tcgtcacgttcgtgcgtggattggctttgatgtagagggctgtcatgcaa ctagagat
gctgtgggtactaacctacctctccagctaggattttctacaggtgttaa cttagtagc
tgtaccgactggttatg
Same sequence is found in the 2020 Genbank submission for SARS-CoV-2 (Wuhan-Hu-1)
https://www.ncbi.nlm.nih.gov/nuccore/NC_045512
Can you explain how that is even possible?
https://academic.oup.com/HTTPHandler...lementary-data
The published genome (2020) of SARS-Cov-2 (Wuhan-Hu-1) from Genbank
https://www.ncbi.nlm.nih.gov/nuccore/NC_045512
here is the 2006 sequence they call SARS-CoV-2 insert, 190 nucleotides long:
atgaattaccaagtcaatggttaccctaatatgtttatcacccgcgaaga agctat
tcgtcacgttcgtgcgtggattggctttgatgtagagggctgtcatgcaa ctagagat
gctgtgggtactaacctacctctccagctaggattttctacaggtgttaa cttagtagc
tgtaccgactggttatg
Same sequence is found in the 2020 Genbank submission for SARS-CoV-2 (Wuhan-Hu-1)
https://www.ncbi.nlm.nih.gov/nuccore/NC_045512
Can you explain how that is even possible?
Where do you find this stuff?
09-17-2023, 09:56 AM
-
#335
- Dave22reborn
- Cold Hearted SOB
-
- Dave22reborn
- Cold Hearted SOB
- Join Date: Jan 2005
- Location: Ill.
- Posts: 120,479
- Rep Power: 316531
-
-
Originally Posted By J.L.C.⏩
And some people like you love em, and your jabs.....Not everybody gets angry about masks. Some people do.
Everybody's different
Everybody's different

09-17-2023, 09:58 AM
-
#336
- Dave22reborn
- Cold Hearted SOB
-
- Dave22reborn
- Cold Hearted SOB
- Join Date: Jan 2005
- Location: Ill.
- Posts: 120,479
- Rep Power: 316531
-
-
Originally Posted By latverian41⏩
That math has led most of the world, including Japan, Germany, Britain, and Australia, to stop recommending Covid boosters for children and teenagers. In fact, the latter three countries no longer recommend Covid shots for the vast majority of people under 65.Just the fact they have to.come out and say publicly that their entire family is getting should be enough to tell people they are being duped into getting these shots
Amazing how people just go along like sheep
Amazing how people just go along like sheep
And yet our leftists from the US are recommending that everyone gets one, including toddlers......
09-17-2023, 10:42 AM
-
#337
Originally Posted By Dave22reborn⏩
Which math?That math has led most of the world, including Japan, Germany, Britain, and Australia, to stop recommending Covid boosters for children and teenagers. In fact, the latter three countries no longer recommend Covid shots for the vast majority of people under 65.
And yet our leftists from the US are recommending that everyone gets one, including toddlers......
And yet our leftists from the US are recommending that everyone gets one, including toddlers......
09-17-2023, 10:52 AM
-
#338
- jtaylor2010
- Join Date: Mar 2010
- Location: United States
- Posts: 33,186
- Rep Power: 441972
-
-
Originally Posted By J.L.C.⏩
I’m assuming it likely has to do with the ratio of lives saved vs cases of myocarditis, which has already been pointed out to you but for some reason you still play dumb.Which math?
09-17-2023, 10:57 AM
-
#339
09-17-2023, 11:15 AM
-
#340
- jtaylor2010
- Join Date: Mar 2010
- Location: United States
- Posts: 33,186
- Rep Power: 441972
-
-
Originally Posted By J.L.C.⏩
No, the CDC’s math….the math that you saw on the slide I directed you to after you suggested it didn’t exist. Like you are once again doing for some reason.Oh, so berenson's math?
09-17-2023, 11:21 AM
-
#341
Originally Posted By jtaylor2010⏩
The same slide that showed 0 myocarditis cases?No, the CDC’s math….the math that you saw on the slide I directed you to after you suggested it didn’t exist. Like you are once again doing for some reason.
How did he calculate 100,000 - 200,000 from the RR's?
09-17-2023, 11:24 AM
-
#342
- jtaylor2010
- Join Date: Mar 2010
- Location: United States
- Posts: 33,186
- Rep Power: 441972
-
-
Originally Posted By J.L.C.⏩
I was planning to move on to that as soon as you acknowledged the ratio of saved lives(at MOST is 1, likely lower than that) to cases of myocarditis. Did you see that part?How did he calculate 100,000 - 200,000 from the RR's?
09-17-2023, 11:29 AM
-
#343
Originally Posted By jtaylor2010⏩
Yep!I was planning to move on to that as soon as you acknowledged the ratio of saved lives(at MOST is 1, likely lower than that) to cases of myocarditis. Did you see that part?
I dunno how you'd expect there to be less than zero cases of myocarditis.
09-17-2023, 11:35 AM
-
#344
- jtaylor2010
- Join Date: Mar 2010
- Location: United States
- Posts: 33,186
- Rep Power: 441972
-
-
Originally Posted By J.L.C.⏩
At MOST one live is saved for every million doses provided to that age group. Meanwhile it isn’t zero cases of myocarditis per 1 million, it’s 0 per 55,649 in males, and slightly less frequent in females. That’s because you would expect to see a case for every 55,650 doses administered(assuming they aren’t lowballing it because it’s quite likely many cases have gone unreported thus far).Yep!
I dunno how you'd expect there to be less than zero cases of myocarditis.
I dunno how you'd expect there to be less than zero cases of myocarditis.
09-17-2023, 11:41 AM
-
#345
Originally Posted By jtaylor2010⏩
0 in both makes and females. How could it be less than 0?At MOST one live is saved for every million doses provided to that age group. Meanwhile it isn’t zero cases of myocarditis per 1 million, it’s 0 per 55,649 in males, and slightly less frequent in females. That’s because you would expect to see a case for every 55,650 doses administered(assuming they aren’t lowballing it because it’s quite likely many cases have gone unreported thus far).
09-17-2023, 11:47 AM
-
#346
- jtaylor2010
- Join Date: Mar 2010
- Location: United States
- Posts: 33,186
- Rep Power: 441972
-
-
Originally Posted By J.L.C.⏩
Long Covid acting up again I see. Oh well, no use continuing to try to explain things to you that you are clearly incapable of understanding and/or remembering. I’m sure others have found useful information in this thread. I’m also sure you’re a member of the “boost for life” crew and nothing I share with you will make you change your mind. Luckily for you they’ll be rolling out your next fix soon. Good luck avoiding adverse events!0 in both makes and females. How could it be less than 0?
09-17-2023, 11:51 AM
-
#347
Originally Posted By jtaylor2010⏩
Base rate of adolescent myo is usually 12-20 per 100,000Long Covid acting up again I see. Oh well, no use continuing to try to explain things to you that you are clearly incapable of understanding and/or remembering. I’m sure others have found useful information in this thread. I’m also sure you’re a member of the “boost for life” crew and nothing I share with you will make you change your mind. Luckily for you they’ll be rolling out your next fix soon. Good luck avoiding adverse events!
You aren't sharing anything, Berenson is sharing hot takes, through you.
09-17-2023, 06:55 PM
-
#348
- Paul Kreul
- Registered User
-
- Paul Kreul
- Registered User
- Join Date: Apr 2006
- Location: United States
- Posts: 33,385
- Rep Power: 316746
-
-
Originally Posted By J.L.C.⏩
190 long..26 matching..position 18253:So it's 190 now? Not 26?
Where do you find this stuff?
Where do you find this stuff?
18241 ggttacccta acatgtttat cacccgcgaa gaagctataa gacatgtacg tgcatggatt
Wanna explain how that is possible?
What’s the date on this paper..?
09-17-2023, 07:38 PM
-
#349
Originally Posted By Paul
They already have the next one!190 long..26 matching..position 18253:
18241 ggttacccta acatgtttat cacccgcgaa gaagctataa gacatgtacg tgcatggatt
Wanna explain how that is possible?
What’s the date on this paper..?
18241 ggttacccta acatgtttat cacccgcgaa gaagctataa gacatgtacg tgcatggatt
Wanna explain how that is possible?
What’s the date on this paper..?
#DashesDontMatter
09-18-2023, 02:00 AM
-
#350
- ViolentZ
- Registered User
-
- ViolentZ
- Registered User
- Join Date: Nov 2008
- Age: 38
- Posts: 9,063
- Rep Power: 0
-
-
Originally Posted By Paul
why dont u provide the link instead of a fake news image190 long..26 matching..position 18253:
18241 ggttacccta acatgtttat cacccgcgaa gaagctataa gacatgtacg tgcatggatt
Wanna explain how that is possible?
What’s the date on this paper..?

18241 ggttacccta acatgtttat cacccgcgaa gaagctataa gacatgtacg tgcatggatt
Wanna explain how that is possible?
What’s the date on this paper..?
~~^^Misc Twitter Crew^^~~
RonPaul2012
Wise words from Dr. Ron Paul: Maximalizing the individual Freedom leads to diminishing the Equality and to the neglect of Solidarity
Reminder: America is a terrorist nation.
Bookmarks
-
- Digg
-
- del.icio.us
-

- StumbleUpon
-
-
Posting Permissions
- You may not post new threads
- You may not post replies
- You may not post attachments
- You may not edit your posts