Log In

Your email is not your username

Register

If you were a member of the old Bodybuilding.com forums and would like to reuse your previous username, you can request it below. We use your email only for registration and do not store it. For more information, please see our Privacy Policy.

Confirm your email

A registration code was sent to your email. Enter it here.

Welcome

You have successfully setup your account.

Sign in

Quick Navigation Bottom Misc
Forum
» It’s Official - Boosters For Everyone!
  1. Results 331 to 350 of 350
  2. First
  3. 10
  4. 11
  5. 12
post 1690204843 09-17-2023, 08:26 AM
-
#331
  1. x-trainer ben
  2. Registered User
  1. x-trainer ben
  2. Registered User
  3. Join Date: Oct 2005
  4. Location: United States
  5. Posts: 62,386
  6. Rep Power: 451180
Originally Posted By Bushmaster
Lol right Benny.. You Rnaholic fux shiit your pants in horror every time a fresh new variant drops. Get all tingly and excited in anticipation of a new vax for it too.



And when it does you Rnaholic fux shiit your pants in horror every time a fresh new variant drops. Get all tingly and excited in anticipation of a new vax for it too.



But it's still funny.
And what current new questions did you asked me in your old man rambling?
That's right none............ you just made statements that were not factual, accurate, or correct( the old people call that lying).
Bless your heart.....
You should just talk to yourself here.

You really don't need anyone else to respond at all, when you just make chit up and reply to yourself.
Aee are on to you and your game.
There is an unspoken thing, we are iron brothers and sisters, we are to support each other and...It is our duty to support our brothers and sisters in the iron game!
post 1690205693 09-17-2023, 08:46 AM
-
#332
  1. Bushmaster
  2. Masculine Toxicity
  1. Bushmaster
  2. Masculine Toxicity
  3. Join Date: Jul 2003
  4. Location: Greenville, South Carolina, United States
  5. Posts: 68,361
  6. Subscribers: 2
  7. Rep Power: 700751
Originally Posted By uncle
And what current new questions did you asked me in your old man rambling?
That's right none............ you just made statements that were not factual, accurate, or correct( the old people call that lying).
Bless your heart.....
You should just talk to yourself here.

You really don't need anyone else to respond at all, when you just make chit up and reply to yourself.
Aee are on to you and your game.
I didn't ask you any questions Benny. Know why.?

1. I'm not interested in hearing any of your Rona paranoia.

2. I have no desire to learn anything about your sacred Rona.

3. It's much more fun to LMAO at you.
It's a hot night. The mind races. You think about your knife: the only friend who hasn't betrayed you, the only friend who won't be dead by sunup. Sleep tight mates, in your quilted chambray night shirts.
post 1690206983 09-17-2023, 09:10 AM
-
#333
  1. Paul Kreul
  2. Registered User
  1. Paul Kreul
  2. Registered User
  3. Join Date: Apr 2006
  4. Location: United States
  5. Posts: 33,385
  6. Rep Power: 316746
Originally Posted By J.L.C.
If you want to claim that assay is identical to current commercial assays for covid, that's gonna require some support/evidence

There's more to it than length (that's what he/she said).

Does it differentiate between dead and alive nucleotides?

Why don't skeptics just publish the sequences and mass spec results?
https://www.researchgate.net/publica...irus_assays_14

https://academic.oup.com/HTTPHandler...lementary-data



The published genome (2020) of SARS-Cov-2 (Wuhan-Hu-1) from Genbank

https://www.ncbi.nlm.nih.gov/nuccore/NC_045512

here is the 2006 sequence they call SARS-CoV-2 insert, 190 nucleotides long:
atgaattaccaagtcaatggttaccctaatatgtttatcacccgcgaaga agctat​
tcgtcacgttcgtgcgtggattggctttgatgtagagggctgtcatgcaa ctagagat
gctgtgggtactaacctacctctccagctaggattttctacaggtgttaa cttagtagc
tgtaccgactggttatg


Same sequence is found in the 2020 Genbank submission for SARS-CoV-2 (Wuhan-Hu-1)

https://www.ncbi.nlm.nih.gov/nuccore/NC_045512


Can you explain how that is even possible?
post 1690207223 09-17-2023, 09:14 AM
-
#334
  1. J.L.C.
  2. Wat
  1. J.L.C.
  2. Wat
  3. Join Date: Apr 2005
  4. Posts: 33,220
  5. Rep Power: 37920
Originally Posted By Paul
https://www.researchgate.net/publica...irus_assays_14

https://academic.oup.com/HTTPHandler...lementary-data



The published genome (2020) of SARS-Cov-2 (Wuhan-Hu-1) from Genbank

https://www.ncbi.nlm.nih.gov/nuccore/NC_045512

here is the 2006 sequence they call SARS-CoV-2 insert, 190 nucleotides long:
atgaattaccaagtcaatggttaccctaatatgtttatcacccgcgaaga agctat​
tcgtcacgttcgtgcgtggattggctttgatgtagagggctgtcatgcaa ctagagat
gctgtgggtactaacctacctctccagctaggattttctacaggtgttaa cttagtagc
tgtaccgactggttatg


Same sequence is found in the 2020 Genbank submission for SARS-CoV-2 (Wuhan-Hu-1)

https://www.ncbi.nlm.nih.gov/nuccore/NC_045512


Can you explain how that is even possible?
So it's 190 now? Not 26?

Where do you find this stuff?
post 1690208983 09-17-2023, 09:56 AM
-
#335
  1. Dave22reborn
  2. Cold Hearted SOB
  1. Dave22reborn
  2. Cold Hearted SOB
  3. Join Date: Jan 2005
  4. Location: Ill.
  5. Posts: 120,479
  6. Rep Power: 316531
Originally Posted By J.L.C.
Not everybody gets angry about masks. Some people do.

Everybody's different
And some people like you love em, and your jabs.....
post 1690209083 09-17-2023, 09:58 AM
-
#336
  1. Dave22reborn
  2. Cold Hearted SOB
  1. Dave22reborn
  2. Cold Hearted SOB
  3. Join Date: Jan 2005
  4. Location: Ill.
  5. Posts: 120,479
  6. Rep Power: 316531
Originally Posted By latverian41
Just the fact they have to.come out and say publicly that their entire family is getting should be enough to tell people they are being duped into getting these shots

Amazing how people just go along like sheep
That math has led most of the world, including Japan, Germany, Britain, and Australia, to stop recommending Covid boosters for children and teenagers. In fact, the latter three countries no longer recommend Covid shots for the vast majority of people under 65.

And yet our leftists from the US are recommending that everyone gets one, including toddlers......
post 1690211053 09-17-2023, 10:42 AM
-
#337
  1. J.L.C.
  2. Wat
  1. J.L.C.
  2. Wat
  3. Join Date: Apr 2005
  4. Posts: 33,220
  5. Rep Power: 37920
Originally Posted By Dave22reborn
That math has led most of the world, including Japan, Germany, Britain, and Australia, to stop recommending Covid boosters for children and teenagers. In fact, the latter three countries no longer recommend Covid shots for the vast majority of people under 65.

And yet our leftists from the US are recommending that everyone gets one, including toddlers......
Which math?
post 1690211353 09-17-2023, 10:52 AM
-
#338
  1. jtaylor2010
  1. jtaylor2010
  2. Join Date: Mar 2010
  3. Location: United States
  4. Posts: 33,186
  5. Rep Power: 441972
Originally Posted By J.L.C.
Which math?
I’m assuming it likely has to do with the ratio of lives saved vs cases of myocarditis, which has already been pointed out to you but for some reason you still play dumb.
post 1690211453 09-17-2023, 10:57 AM
-
#339
  1. J.L.C.
  2. Wat
  1. J.L.C.
  2. Wat
  3. Join Date: Apr 2005
  4. Posts: 33,220
  5. Rep Power: 37920
Originally Posted By jtaylor2010
I’m assuming it likely has to do with the ratio of lives saved vs cases of myocarditis, which has already been pointed out to you but for some reason you still play dumb.
Oh, so berenson's math?
post 1690212173 09-17-2023, 11:15 AM
-
#340
  1. jtaylor2010
  1. jtaylor2010
  2. Join Date: Mar 2010
  3. Location: United States
  4. Posts: 33,186
  5. Rep Power: 441972
Originally Posted By J.L.C.
Oh, so berenson's math?
No, the CDC’s math….the math that you saw on the slide I directed you to after you suggested it didn’t exist. Like you are once again doing for some reason.
post 1690212373 09-17-2023, 11:21 AM
-
#341
  1. J.L.C.
  2. Wat
  1. J.L.C.
  2. Wat
  3. Join Date: Apr 2005
  4. Posts: 33,220
  5. Rep Power: 37920
Originally Posted By jtaylor2010
No, the CDC’s math….the math that you saw on the slide I directed you to after you suggested it didn’t exist. Like you are once again doing for some reason.
The same slide that showed 0 myocarditis cases?

How did he calculate 100,000 - 200,000 from the RR's?
post 1690212573 09-17-2023, 11:24 AM
-
#342
  1. jtaylor2010
  1. jtaylor2010
  2. Join Date: Mar 2010
  3. Location: United States
  4. Posts: 33,186
  5. Rep Power: 441972
Originally Posted By J.L.C.
How did he calculate 100,000 - 200,000 from the RR's?
I was planning to move on to that as soon as you acknowledged the ratio of saved lives(at MOST is 1, likely lower than that) to cases of myocarditis. Did you see that part?
post 1690212773 09-17-2023, 11:29 AM
-
#343
  1. J.L.C.
  2. Wat
  1. J.L.C.
  2. Wat
  3. Join Date: Apr 2005
  4. Posts: 33,220
  5. Rep Power: 37920
Originally Posted By jtaylor2010
I was planning to move on to that as soon as you acknowledged the ratio of saved lives(at MOST is 1, likely lower than that) to cases of myocarditis. Did you see that part?
Yep!

I dunno how you'd expect there to be less than zero cases of myocarditis.
post 1690213143 09-17-2023, 11:35 AM
-
#344
  1. jtaylor2010
  1. jtaylor2010
  2. Join Date: Mar 2010
  3. Location: United States
  4. Posts: 33,186
  5. Rep Power: 441972
Originally Posted By J.L.C.
Yep!

I dunno how you'd expect there to be less than zero cases of myocarditis.
At MOST one live is saved for every million doses provided to that age group. Meanwhile it isn’t zero cases of myocarditis per 1 million, it’s 0 per 55,649 in males, and slightly less frequent in females. That’s because you would expect to see a case for every 55,650 doses administered(assuming they aren’t lowballing it because it’s quite likely many cases have gone unreported thus far).
post 1690213543 09-17-2023, 11:41 AM
-
#345
  1. J.L.C.
  2. Wat
  1. J.L.C.
  2. Wat
  3. Join Date: Apr 2005
  4. Posts: 33,220
  5. Rep Power: 37920
Originally Posted By jtaylor2010
At MOST one live is saved for every million doses provided to that age group. Meanwhile it isn’t zero cases of myocarditis per 1 million, it’s 0 per 55,649 in males, and slightly less frequent in females. That’s because you would expect to see a case for every 55,650 doses administered(assuming they aren’t lowballing it because it’s quite likely many cases have gone unreported thus far).
0 in both makes and females. How could it be less than 0?
post 1690213963 09-17-2023, 11:47 AM
-
#346
  1. jtaylor2010
  1. jtaylor2010
  2. Join Date: Mar 2010
  3. Location: United States
  4. Posts: 33,186
  5. Rep Power: 441972
Originally Posted By J.L.C.
0 in both makes and females. How could it be less than 0?
Long Covid acting up again I see. Oh well, no use continuing to try to explain things to you that you are clearly incapable of understanding and/or remembering. I’m sure others have found useful information in this thread. I’m also sure you’re a member of the “boost for life” crew and nothing I share with you will make you change your mind. Luckily for you they’ll be rolling out your next fix soon. Good luck avoiding adverse events!
post 1690214153 09-17-2023, 11:51 AM
-
#347
  1. J.L.C.
  2. Wat
  1. J.L.C.
  2. Wat
  3. Join Date: Apr 2005
  4. Posts: 33,220
  5. Rep Power: 37920
Originally Posted By jtaylor2010
Long Covid acting up again I see. Oh well, no use continuing to try to explain things to you that you are clearly incapable of understanding and/or remembering. I’m sure others have found useful information in this thread. I’m also sure you’re a member of the “boost for life” crew and nothing I share with you will make you change your mind. Luckily for you they’ll be rolling out your next fix soon. Good luck avoiding adverse events!
Base rate of adolescent myo is usually 12-20 per 100,000

You aren't sharing anything, Berenson is sharing hot takes, through you.
post 1690232473 09-17-2023, 06:55 PM
-
#348
  1. Paul Kreul
  2. Registered User
  1. Paul Kreul
  2. Registered User
  3. Join Date: Apr 2006
  4. Location: United States
  5. Posts: 33,385
  6. Rep Power: 316746
Originally Posted By J.L.C.
So it's 190 now? Not 26?

Where do you find this stuff?
190 long..26 matching..position 18253:

18241 ggttacccta acatgtttat cacccgcgaa gaagctataa gacatgtacg tgcatggatt

Wanna explain how that is possible?

What’s the date on this paper..?

post 1690234423 09-17-2023, 07:38 PM
-
#349
  1. J.L.C.
  2. Wat
  1. J.L.C.
  2. Wat
  3. Join Date: Apr 2005
  4. Posts: 33,220
  5. Rep Power: 37920
Originally Posted By Paul
190 long..26 matching..position 18253:

18241 ggttacccta acatgtttat cacccgcgaa gaagctataa gacatgtacg tgcatggatt

Wanna explain how that is possible?

What’s the date on this paper..?
They already have the next one!

#DashesDontMatter
post 1690245583 09-18-2023, 02:00 AM
-
#350
  1. ViolentZ
  2. Registered User
  1. ViolentZ
  2. Registered User
  3. Join Date: Nov 2008
  4. Age: 38
  5. Posts: 9,063
  6. Rep Power: 0
Originally Posted By Paul
190 long..26 matching..position 18253:

18241 ggttacccta acatgtttat cacccgcgaa gaagctataa gacatgtacg tgcatggatt

Wanna explain how that is possible?

What’s the date on this paper..?

why dont u provide the link instead of a fake news image
~~^^Misc Twitter Crew^^~~
RonPaul2012
Wise words from Dr. Ron Paul: Maximalizing the individual Freedom leads to diminishing the Equality and to the neglect of Solidarity

Reminder: America is a terrorist nation.
Quick Navigation Top Misc
Bookmarks
Digg.com
Digg
del.icio.us
del.icio.us
Stumbleupon.com
StumbleUpon
Google.com
Google
Facebook.com
Facebook
Posting Permissions
  1. You may not post new threads
  2. You may not post replies
  3. You may not post attachments
  4. You may not edit your posts